Practice question
Question
Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is:
Explanation
In molecular biology, nucleic acid structure and recombination dictates that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Therefore GCGCGTGCATGCCCGATGCC is correct as it matches molecular mechanisms of gene expression, supported by mechanistic studies and conserved across related systems.
Related blogs
Guides and insights connected to this topic
Zoonotic Spillover in Bats: Causes, Consequences, and Future Preparedness
Bats: General Characteristics and Classification Bats are small mammals capable of true sustained flight. They belong to the second-largest...
Protein Databases: Definition, Types, Examples, Uses
Introduction to Protein DatabasesProtein databases are specialized biological databases that store comprehensive information about proteins....
Tissues in Action Notes - Plant and Animal Tissues, Meristematic, Epithelial, Connective and Muscular
Explore how cells form tissues in plants and animals, covering meristematic, epithelial, connective and muscular types, and why their structures differ.
Discussion
Comments
Please log in to join the discussion.
Login to commentNo comments yet. Be the first to start the discussion.