Biochemistry and Molecular Biology

Biochemistry and Molecular Biology

Which one of the following is associated with RNA-induced gene silencing in plants?

The principle of nucleic acid structure and recombination explains that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Hence DNA methylation fits best because it matches molecular mechanisms of gene expression, as documented in authoritative sources on molecular biology.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

An experiment involves formation of RNA-DNA hybrid. Which one of the following enzymes could be utilized to degrade only

nucleic acid structure and recombination analysis shows hairpin formation, Holliday junction resolution and translation control ensure fidelity. Consequently RNase H emerges as the valid choice since it matches molecular mechanisms of gene expression, aligning with established principles in molecular biology literature.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

For efficient translation of certain eukaryotic mRNAs under many physiological and pathological stress conditions, the s

In molecular biology, nucleic acid structure and recombination dictates that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Therefore Internal ribosome entry sites. is correct as it matches molecular mechanisms of gene expression, supported by mechanistic studies and conserved across related systems.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

In a class, students were divided into 3 different groups and each group was given different DNA sample to find the melt

The principle of nucleic acid structure and recombination explains that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Hence They got different DNA samples with same length and same GC content. fits best because it matches molecular mechanisms of gene expression, as documented in authoritative sources on molecular

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, Chapter 9, Transcription and RNA Processing, describes RNA hairpin formation, secondary structures and regulatory mechanisms controlling gene expression in prokaryotes and eukaryotes.

View Details

Biochemistry and Molecular Biology

What is the minimum number of tRNAs required to recognize all six codons of serine (UCU, UCA, UCG, UCC, AGU, and AGC)

In molecular biology, nucleic acid structure and recombination dictates that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Therefore 3 is correct as it matches molecular mechanisms of gene expression, supported by mechanistic studies and conserved across related systems.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

CRISPR/Cas9 is an example of bacterial adaptive immunity. The transcription of CRISPR loci generates small crispr-RNAs (

nucleic acid structure and recombination analysis shows hairpin formation, Holliday junction resolution and translation control ensure fidelity. Consequently absence of protospacer adjacent motif sequence in CRISPR loci. emerges as the valid choice since it matches molecular mechanisms of gene expression, aligning with established principles in molecular biology literature.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

Underwinding or overwinding of circular dsDNA generates supercoils only when it does NOT have any of the following:

nucleic acid structure and recombination analysis shows hairpin formation, Holliday junction resolution and translation control ensure fidelity. Consequently Nicks emerges as the valid choice since it matches molecular mechanisms of gene expression, aligning with established principles in molecular biology literature.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, Chapter 9, Transcription and RNA Processing, describes RNA hairpin formation, secondary structures and regulatory mechanisms controlling gene expression in prokaryotes and eukaryotes.

View Details

Biochemistry and Molecular Biology

A tRNA containing an anticodon for leucine was charged with leucine. Subsequently, the attached leucine was chemically m

Mechanistically, nucleic acid structure and recombination involves hairpin formation, Holliday junction resolution and translation control ensure fidelity. This validates Arginine against codon of leucine in mRNA. because it matches molecular mechanisms of gene expression, a pattern repeatedly demonstrated in molecular biology research.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, Chapter 9, Transcription and RNA Processing, describes RNA hairpin formation, secondary structures and regulatory mechanisms controlling gene expression in prokaryotes and eukaryotes.

View Details

Biochemistry and Molecular Biology

All the DNA strands of a cell containing 4 chromosomes are labelled. After one division how many chromosomes in the daug

Mechanistically, nucleic acid structure and recombination involves hairpin formation, Holliday junction resolution and translation control ensure fidelity. This validates 4 because it matches molecular mechanisms of gene expression, a pattern repeatedly demonstrated in molecular biology research.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

The sequence of first strand of DNA obtained after reverse transcription of a bacterial mRNA is the same as:

The principle of nucleic acid structure and recombination explains that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Hence Anti-sense DNA strand fits best because it matches molecular mechanisms of gene expression, as documented in authoritative sources on molecular biology.

Ref: Alberts et al., Molecular Biology of the Cell, 6th Edition, Chapter 5, DNA Replication and Repair, discusses Holliday junction formation during homologous recombination and replication fork dynamics ensuring genome duplication and stability.

View Details

Biochemistry and Molecular Biology

Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is:

In molecular biology, nucleic acid structure and recombination dictates that hairpin formation, Holliday junction resolution and translation control ensure fidelity. Therefore GCGCGTGCATGCCCGATGCC is correct as it matches molecular mechanisms of gene expression, supported by mechanistic studies and conserved across related systems.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, Chapter 9, Transcription and RNA Processing, describes RNA hairpin formation, secondary structures and regulatory mechanisms controlling gene expression in prokaryotes and eukaryotes.

View Details

Biochemistry and Molecular Biology

Which of the following is NOT true of protein folds?

In biochemistry, enzyme catalysis and lipid structure dictates that substrate affinity, transition state stabilization and phospholipid composition govern function. Therefore A stable fold is a prerequisite for the function of all proteins is correct as it reflects catalytic efficiency and membrane organization, supported by mechanistic studies and conserved across related

Ref: Berg, Tymoczko, Gatto and Stryer, Biochemistry, 9th Edition, Chapter 13, Metabolism and Bioenergetics, covers glycolysis, citric acid cycle, oxidative phosphorylation and NADH-linked reactions detailing biochemical principles of cellular energy metabolism.

View Details