Practice question
Question
The primary sequence of a miRNA is given below. 5' - UAGCUUAUCAGACUGAUGUUGA - 3' The seed region of miRNA starts from the 2ⁿᵈposition to the 8ᵗʰposition. Which one of the following mRNA sequences would be targeted by the above miRNA?
Explanation
the primary sequence of a mirna is operates via 5' - CUCGAGGAUCAUCAGUCUGAUAAGCUAGAGCUC - 3' represents established outcome. functional assays validates option A. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.
Related blogs
Guides and insights connected to this topic
Gene - Definition, Structure, Types, Regulation, Mutations, Inheritance and Gene Therapy
A gene is a DNA segment coding for RNA or protein, the basic hereditary unit. Covers gene structure, types, regulation, mutations, inheritance patterns, and therapeutic
Comparative Genomics: Definition, Methods, Tools and Significance in Genome Evolution
Explore how comparative genomics compares DNA across species, the tools used, and its role in understanding genome evolution.
Zoonotic Spillover in Bats: Causes, Consequences, and Future Preparedness
Bats: General Characteristics and Classification Bats are small mammals capable of true sustained flight. They belong to the second-largest...
Discussion
Comments
Please log in to join the discussion.
Login to commentNo comments yet. Be the first to start the discussion.