Practice question
Question
A DNA sequence is given below: 5' -A TGACGA TGACGAGACGATGCAGATGA T AGCAGT AGCGAA TGAC -3' The following primers were designed to amplify the above sequence: A. 5' -T ACTGCT -3' B. 5' -CAGTAAG -3' C. 5' -ATGACGA-3' D. 5' - GTCATTC - 3' E. 5' -TCGTCAT -3' F. 5' - GAATGAC-3' If we negate the effects of primer length, Tm, %GC and other factors, which one of the following options represents a combination of primers that could amplify the above DNA sequence?
Explanation
In a dna sequence is given below: 5', C and D represents established outcome. functional assays confirms option D (C and D) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.
Related blogs
Guides and insights connected to this topic
Gene - Definition, Structure, Types, Regulation, Mutations, Inheritance and Gene Therapy
A gene is a DNA segment coding for RNA or protein, the basic hereditary unit. Covers gene structure, types, regulation, mutations, inheritance patterns, and therapeutic
Comparative Genomics: Definition, Methods, Tools and Significance in Genome Evolution
Explore how comparative genomics compares DNA across species, the tools used, and its role in understanding genome evolution.
Zoonotic Spillover in Bats: Causes, Consequences, and Future Preparedness
Bats: General Characteristics and Classification Bats are small mammals capable of true sustained flight. They belong to the second-largest...
Discussion
Comments
Please log in to join the discussion.
Login to commentNo comments yet. Be the first to start the discussion.