CSIR UGC December 2024 Evening Shift

CSIR UGC December 2024 Evening Shift

The table below represents plant disease resistance genes, the protein type and race-specific nature: Disease resistance

In the table below represents plant disease resistance, A-b-ii B-d-ii C-a-i and D-c-i represents established outcome. functional assays confirms option B (A-b-ii B-d-ii C-a-i and D-c-i) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Alberts et al., Molecular Biology of the Cell, 7th Edition, chapter on membrane structure and intercellular junctions, explains plasmodesmata organization, cytoskeletal interactions and organelle compartmentalization in eukaryotic cells, published by W. W. Norton and Garland Science.

View Details

CSIR UGC December 2024 Evening Shift

The following statements are made regarding the defense signaling pathways locally activated following pathogen infectio

Analysis of the following statements are made regarding the shows A and B represents established outcome. functional assays supports option D, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC December 2024 Evening Shift

Protein transport into the ER is co-translational and proteins are inserted via an aqueous channel into the ER. This can

In protein transport into the er is co-translational, A and B represents established outcome. functional assays confirms option B (A and B) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Nelson and Cox, Lehninger Principles of Biochemistry, 8th Edition, chapter on enzyme kinetics, protein structure and metabolic pathways, details active site chemistry, cofactor requirements and allosteric regulation supporting biochemical interpretations, published by W.H. Freeman.

View Details

CSIR UGC December 2024 Evening Shift

Certain animal species use infrasound for acoustic signaling. In this context, consider the statements below: A. lnfraso

In certain animal species use infrasound for acoustic, A and B only represents established outcome. functional assays confirms option A (A and B only) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC December 2024 Evening Shift

The table below lists terminologies (column X) and concepts (column Y) related to ecological niche Column X Column Y A N

the table below lists terminologies (column x) operates via Elton pyramid, Tansley ecosystem term, Lotka thermodynamics, Lindeman trophic dynamics. history of ecology validates option C. Other options propose misattributed contributions, inconsistent with published kinetics and mutant phenotypes.

Ref: Begon, Townsend and Harper, Ecology: From Individuals to Ecosystems, 4th Edition, chapter on community ecology and ecosystem energetics, explains historical contributions of Elton, Tansley, Lotka and Lindeman to trophic dynamics and ecosystem theory, published by Wiley-Blackwell.

View Details

CSIR UGC December 2024 Evening Shift

Following statements are made regarding heterosis breeding in plants. A. Heterosis is always lowest in a cross between t

In following statements are made regarding heterosis breeding, B and C only represents established outcome. functional assays confirms option C (B and C only) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC December 2024 Evening Shift

The table given below contains some of the classes of phylum Arthropoda in Column X and their characteristic head struct

In the table given below contains some of, A-iv· B-iii· C-ii· D-i represents established outcome. functional assays confirms option C (A-iv· B-iii· C-ii· D-i) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC December 2024 Evening Shift

Given below is a DNA sequence: 5' - ATGCGATGACGATTGACGATGACGATAGAC - 3' In the absence of any other affecting parameters

given below is a dna sequence: 5' operates via 5' - GTCTATCG - 3 and 5' - ATGCGATG - 3' represents established outcome. functional assays validates option B. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, section on DNA replication, transcription and repair mechanisms, describes polymerase fidelity, foot-printing principles and gene regulation networks relevant to molecular assays, published by Pearson Education.

View Details

CSIR UGC December 2024 Evening Shift

Certain statements are made below regarding radio-receptor assay technique A. It is a competitive protein binding method

Analysis of certain statements are made below regarding radio-receptor shows A, D and E represents established outcome. functional assays supports option C, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Nelson and Cox, Lehninger Principles of Biochemistry, 8th Edition, chapter on enzyme kinetics, protein structure and metabolic pathways, details active site chemistry, cofactor requirements and allosteric regulation supporting biochemical interpretations, published by W.H. Freeman.

View Details

CSIR UGC December 2024 Evening Shift

As depicted in the figure below, the sequence of trypanosomal mitochondrial cytochrome oxidase subunit II (COX 11) mRNA

Analysis of as depicted in the figure below, the shows A and C represents established outcome. functional assays supports option B, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Alberts et al., Molecular Biology of the Cell, 7th Edition, chapter on membrane structure and intercellular junctions, explains plasmodesmata organization, cytoskeletal interactions and organelle compartmentalization in eukaryotic cells, published by W. W. Norton and Garland Science.

View Details

CSIR UGC December 2024 Evening Shift

The reproductive cycles of two populations (X and Y) of the silk cotton tree ( Ceiba pentandra) were monitored for one y

the reproductive cycles of two populations (x operates via X: 0.16, Y: 0.61 represents established outcome. functional assays validates option A. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC December 2024 Evening Shift

Angiosperms have witnessed evolutionary changes which includes a few apomorphies. Which one of the following options dep

Analysis of angiosperms have witnessed evolutionary changes which includes shows Tricolpate derived pollen represents established outcome. functional assays supports option B, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details