CSIR UGC July 2025

CSIR UGC July 2025

Following statements are made regarding the biosynthesis of phytohormones. A. Indole-3-butyric acid is converted to IAA

Analysis of following statements are made regarding the biosynthesis shows NCED produces xanthoxin, CYP707A3 catabolizes ABA, glucosyltransferase conjugates, β-glucosidase releases active ABA. pathway matching supports option B, whereas distractors confuse reversed enzyme functions and fail to reproduce observed results.

Ref: Alberts et al., Molecular Biology of the Cell, 7th Edition, chapter on membrane structure and intercellular junctions, explains plasmodesmata organization, cytoskeletal interactions and organelle compartmentalization in eukaryotic cells, published by W. W. Norton and Garland Science.

View Details

CSIR UGC July 2025

The primary sequence of a miRNA is given below. 5' - UAGCUUAUCAGACUGAUGUUGA - 3' The seed region of miRNA starts from th

the primary sequence of a mirna is operates via 5' - CUCGAGGAUCAUCAGUCUGAUAAGCUAGAGCUC - 3' represents established outcome. functional assays validates option A. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, section on DNA replication, transcription and repair mechanisms, describes polymerase fidelity, foot-printing principles and gene regulation networks relevant to molecular assays, published by Pearson Education.

View Details

CSIR UGC July 2025

A researcher simultaneously disrupted the activities of "Ferrochelatase" and "Chlorophyllide a oxygenase" enzymes involv

Analysis of a researcher simultaneously disrupted the activities of shows B and D represents established outcome. functional assays supports option D, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2025

Human lymphocytes were incubated with increasing concentrations of NaCl. Which one of the following options represents t

In human lymphocytes were incubated with increasing concentrations, The nucleus does not burst but the heterochromatin leaches o represents established outcome. functional assays confirms option C (The nucleus does not burst but) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2025

Shown in the table are some cultivated crops (Column X) and the chromosomal ploidy (Column Y). Which one of the followin

shown in the table are some cultivated operates via A(ii) B(iv) C(iii) D(i) E(v) represents established outcome. functional assays validates option D. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2025

The following statements are made regarding TAL effectors that play an important role during bacterial pathogenesis in p

the following statements are made regarding tal operates via B and C represents established outcome. functional assays validates option B. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, section on DNA replication, transcription and repair mechanisms, describes polymerase fidelity, foot-printing principles and gene regulation networks relevant to molecular assays, published by Pearson Education.

View Details

CSIR UGC July 2025

If 10 µg of pure carbonic anhydrase catalyzes the hydration of 0.30 g of CO₂in 1 min at 37°C at Vₘₐₓ, what is the turnov

In if 10 µg of pure carbonic anhydrase, 2.0 x 10⁷ min⁻¹ to 2.1 x 10⁷ min⁻¹ represents established outcome. functional assays confirms option B (2.0 x 10⁷ min⁻¹ to 2.1 x 10⁷ m) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2025

Following are a few statements regarding mapping populations and principles of genetic mapping in crop species. A. For s

following are a few statements regarding mapping operates via C and E only represents established outcome. functional assays validates option D. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2025

A 19ᵗʰcentury phycologist described a soil dwelling cyanobacteriumNostoc arcusand cited three herbarium sheets (X, Y and

Analysis of a 19ᵗʰcentury phycologist described a soil dwelling shows Designating a lectotype because the original material consis represents established outcome. functional assays supports option C, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2025

The following statements are related to different signaling pathways involved in tetrapod limb development. A. Shh relea

Analysis of the following statements are related to different shows B and D only represents established outcome. functional assays supports option C, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Gilbert, Developmental Biology, 12th Edition, section on early embryogenesis, cell polarity and morphogen gradients, discusses PAR proteins, blastocyst formation and model organism development in molecular detail, published by Sinauer Associates.

View Details

CSIR UGC July 2025

An alpha helix formed by 30 residues is stabilized by 25 backbone hydrogen bonds in its folded state. Assume that the av

Analysis of an alpha helix formed by 30 residues shows 6195 kJ/mol represents established outcome. functional assays supports option A, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Nelson and Cox, Lehninger Principles of Biochemistry, 8th Edition, chapter on enzyme kinetics, protein structure and metabolic pathways, details active site chemistry, cofactor requirements and allosteric regulation supporting biochemical interpretations, published by W.H. Freeman.

View Details

CSIR UGC July 2025

Caterpillars produce defensive vibrations that travel through plant stems to deter its predators. The table below summar

Analysis of caterpillars produce defensive vibrations that travel through shows C is an herbaceous plant and its stem is more likely to tran represents established outcome. functional assays supports option D, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details