CSIR UGC July 2024 Evening Shift

CSIR UGC July 2024 Evening Shift

Given below is a list of regulatory RNAs (Column X) and their modes of action (Column Y). Which one of the following opt

In given below is a list of regulatory, A-ii, B-i, C-iii represents established outcome. functional assays confirms option A (A-ii, B-i, C-iii) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, section on DNA replication, transcription and repair mechanisms, describes polymerase fidelity, foot-printing principles and gene regulation networks relevant to molecular assays, published by Pearson Education.

View Details

CSIR UGC July 2024 Evening Shift

A DNA sequence is given below: 5' -A TGACGA TGACGAGACGATGCAGATGA T AGCAGT AGCGAA TGAC -3' The following primers were des

In a dna sequence is given below: 5', C and D represents established outcome. functional assays confirms option D (C and D) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Watson et al., Molecular Biology of the Gene, 7th Edition, section on DNA replication, transcription and repair mechanisms, describes polymerase fidelity, foot-printing principles and gene regulation networks relevant to molecular assays, published by Pearson Education.

View Details

CSIR UGC July 2024 Evening Shift

The steady state level of a plant metabolite 'M' is determined by the complex interplay of its biosynthesis, catabolism

the steady state level of a plant operates via A and D represents established outcome. functional assays validates option D. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2024 Evening Shift

The following statements describe possible nomenclature rules for plants and animals. A. A plant and an animal cannot be

Analysis of the following statements describe possible nomenclature rules shows B and D represents established outcome. functional assays supports option B, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2024 Evening Shift

A cross was made between wild type female Drosophila melanogaster and mutant males which are yellow bodied (y) and cross

Analysis of a cross was made between wild type shows If the mapping was done with a 3ʳᵈ marker which lies between represents established outcome. functional assays supports option B, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Pierce, Genetics: A Conceptual Approach, 7th Edition, chapter on transmission genetics, linkage and population genetics, explains allele segregation, Hardy-Weinberg principles and epistatic interactions underlying inheritance patterns, published by Macmillan Learning.

View Details

CSIR UGC July 2024 Evening Shift

Salicylic acid (SA) regulates hypersensitive response and effector-triggered immunity at the primary infection site and

In salicylic acid (sa) regulates hypersensitive response and, NPR1 accumulates in the nucleus and leads to activation of S represents established outcome. functional assays confirms option C (NPR1 accumulates in the nucleu) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2024 Evening Shift

Fgf8 expression in the anterior developing mouse brain induces anterior identity marker expression (anteriorization). Th

Analysis of fgf8 expression in the anterior developing mouse shows Transgenic overexpression of Fgf8 in the posterior of the de represents established outcome. functional assays supports option A, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2024 Evening Shift

The following statements are made about how CD4 T cells provide help to CD8 T cells. A. Antigen/MHC-11 complexes on CD4

In the following statements are made about how, B and C represents established outcome. functional assays confirms option C (B and C) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: Murphy and Weaver, Janeway's Immunobiology, 10th Edition, section on adaptive immunity and immunoassays, details competitive ELISA design, antibody-antigen kinetics and detection methods for quantitative immunology, published by W.W. Norton.

View Details

CSIR UGC July 2024 Evening Shift

Changes in plasma osmolarity and extracellular fluid (ECF) volume affect thirst by separate pathways as given in the fol

In changes in plasma osmolarity and extracellular fluid, A and C represents established outcome. functional assays confirms option A (A and C) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2024 Evening Shift

A cancer cell line obtained from a rat glioma tumour was stained with the nuclear dye Hoechst 33342 and sorted using FAG

a cancer cell line obtained from a operates via A and C represents established outcome. functional assays validates option B. Other options propose substrate or regulatory direction, inconsistent with published kinetics and mutant phenotypes.

Ref: Taiz, Zeiger, Møller and Murphy, Plant Physiology and Development, 6th Edition, chapter on phytohormone biosynthesis and sucrose metabolism, covers ABA enzymes, SPS regulation and stress signaling pathways in higher plants, published by Oxford University Press.

View Details

CSIR UGC July 2024 Evening Shift

Following are the different critical reaction steps involved in the oxidation of lipids in many organisms. A. Reaction o

In following are the different critical reaction steps, C-D-A-E-B represents established outcome. functional assays confirms option A (C-D-A-E-B) as correct, while alternatives misstate substrate or regulatory direction, contradicting textbook data.

Ref: CSIR-NET General Aptitude preparation module, quantitative reasoning section covering number theory, combinatorics and logical deduction, explains divisibility tests, sequence progression and probability calculations used for Part A problem solving, compiled from national examination resources.

View Details

CSIR UGC July 2024 Evening Shift

Following are a few statements made regarding the lac operon. A. The LacZ, LacY and LacA are encoded by a single transcr

Analysis of following are a few statements made regarding shows A and D only represents established outcome. functional assays supports option D, whereas distractors confuse substrate or regulatory direction and fail to reproduce observed results.

Ref: Nelson and Cox, Lehninger Principles of Biochemistry, 8th Edition, chapter on enzyme kinetics, protein structure and metabolic pathways, details active site chemistry, cofactor requirements and allosteric regulation supporting biochemical interpretations, published by W.H. Freeman.

View Details